Organe pe un cip, noua descoperire de la Harvard

tradus din A cultural revolution in the study of the gut microbiome

Mai mult de un milion de americani suferă de diferite forme ale sindromului colonului iritabil (printre acestea numărându-se colita și boala Crohn). Se crede că sistemul imunitar defectuos provoacă aceste boli, alături de problemele legate de microbiomul intestinal (totalitatea microorganismelor din colon) sau problemele asociate celulelor epiteliale ale intestinului.
Până acum cercetătorilor le-a fost greu să dezvolte terapii pentru tratarea sindromul colonului iritabil datorită faptului că mediul intestinal este greu de simulat în laborator.

Acum, o echipă de la Institutul Wyss, asociat Universității Harvard, a folosit tehnologia human-organs-on-chips (organe umane pe cipuri) pentru a crea un model al inflamării colonului uman pe un astfel de cip. Descoperirea, publicată în revista Proceedings of the National Academy of Sciences (PNAS), descrie cum, pentru prima oară, cercetătorii pot analiza felul în care flora intestinală normală și organismele patogene contribuie la stimularea sistemului imunitar, dar și mecanismele care determină sindromul colonului iritabil într-un model care replică fiziologia intestinului uman.

“Se crede că inflamarea cronică a intestinelor este cauzată de interacțiunile anormale dintre microbii din intestin, celulele epiteliale și sistemul imunitar, dar mecanismele exacte nu au fost înca determinate”, a declarat Dr. Hyun Jung Kim, prim autor al studiului.

Cu toate acestea, tehnologia “intestinul uman pe un cip” este un mediu ideal pentru replicarea condițiilor naturale ale intestinului uman într-o platformă controlabilă și la scară mică. “Intestinul uman pe un cip” a fost inventat la Institutul Wyss în 2012. Este făcut dintr-un polimer flexibil de mărimea unui stick de memorie, iar canalele dispozitivului simulează structura fizică, micro-mediul și miscările peristaltice specifice intestinelor umane.

Studiul publicat în PNAS prezintă felul în care, pe “intestinul uman pe un cip”, se pot co-cultiva celule intestinale și microbi din intestinul uman, timp de o perioadă de până la două săptămâni. Acest sistem permine studierea vieții microbilor și contribuția lor la bolile și la sănătatea oamenilor.

“Descoperirea microbiomului și a semnificației acestuia reprezintă o importantă schimbare de paradigmă în înțelegerea sănătății umane – există mai mulți microbi care trăiesc pe noi, decât celule în corpul uman”, a declarat Ingber, profesor la Harvard Medical School.
“Până acum, metodele tradiționale de cultivare ale microbilor nu permiteau studierea microbiomului pe o perioadă mai lungă de una sau două zile.”

“Sunt multe lucruri pe care încă nu le cunoaștem despre sindromul colonului iritabil, dar și despre modul în care antibioticele acționează asupra microbiomului”, a declarat Collins, profesor la Massachusetts Institute of Technology.

Noul cip a dus deja la noi descoperiri, cum ar fi faptul că patru mici proteine care stimulează inflamația (numite citochine) funcționează în tandem și cauzează răspunsuri imunitare care irită intestinele.
Noile terapii ar putea “bloca” aceste citochine.

Echipa de la Institutul Wyzz crede că “intestinul uman pe un cip” ar putea contribui la domeniul “medicinei precise”. Celulele unui pacient și microbii acestuia ar putea fi co-cultivate într-un astfel de cip pentru testarea diferitelor terapii și pentru identificarea tratamentelor personalizate.

Editarea genelor – Cut & Paste

CRISPR_scissorsUnul dintre cele mai discutate subiecte legate de știință în 2015 a fost editarea genelor.

“Instrumentul de editare a genelor, CRISPR-Cas9, care funcţionează ca un fel de foarfeci la nivel molecular, este capabil să îndepărteze, selectiv, părţile nedorite dintr-un genom” (mediafax).

Studentul chinez Junjiu Huang, de la Universitatea Sun Yat-sen University din Guangzhou, a fost primul om de știință care publicat un articol despre editarea genelor în embrioni vii. El a fost desemnat de revista Nature ca fiind unul dintre cei mai importanți oameni de știință ai anului 2015.

Huang a folosit tehnologia CRISPR–Cas9,  pentru a modifica genele care cauzează boala β-thalassaemia. Huang a folosit în experimentele sale embrioni de la clinicile de fertilizare in vitro (care nu puteau progresa spre organisme mature).

Oamenii de știință speră că editarea genelor folosind tehnologia CRISPR–Cas9 în embrioni vii ar putea elimina bolile genetice.

Rezultatele lui Huang au dovedit, din păcate, că tehnologia CRISPR–Cas9 nu este încă suficient de sigură pentru a evita efectele secundare.  Cu toate acestea, oamenii de știință, dar și politicienii, au fost complet “electrizați” de descoperirile sale.

În 3 decembrie a avut loc la Academia de Științe din Statele Unite din Wachington D.C. o întâlnire la nivel înalt dedicată  editării genelor (The International Summit on Human Gene Editing), la care au participat Academiile de Științe și Medicină din SUA, Royal Society din MArea Britanie și Academia de Științe din China.

Una dintre concluziile întâlnirii a fost că editarea genelor în embrionii umani nu ar trebui interzisă în nicio țară, ci doar strict reglementată. Interzicerea editării genelor în embrioni în unele țări ar duce doar la mutarea experimentelor în alte țări, unde legile sunt mai permisive. Raportul întâlnirii va fi publicat doar în 2016.

Oamenii de știință care au participat la întâlnire au căzut de acord asupra următorul aspect al problemei: Tehnologia de editare a genelor nu trebuie folosită în embrionii vii și care urmează să să fie implantați în uter.

Referințe

http://www.nature.com/news/365-days-nature-s-10-1.19018

http://www.nature.com/news/gene-editing-summit-supports-some-research-in-human-embryos-1.18947

Imagine

Schimbarile produse de aparitia agriculturii, deduse din mostre de ADN antic

Agricultura a apărut în Europa acum aproximativ 8500 de ani și a determinat adaptarea oamenilor la noi medii de viață, la noi agenți patogeni, la noi diete și la noi forme de organizare socială. Procesul adaptarii oamenilor la toți acești factori poate fi cu greu dedus studiind doar populațiilor contemporane.

Populațiile contemporane sunt rezultatul multor valuri de modificări genetice, fapt care îngreunează deducerea ordinii evenimentelor de adaptare.

În sprijinul cercetătorilor care se ocupă de studiul adaptabilității și selecției vine ADN-ul populațiilor antice, care este acum accesibil datorită noilor tehnologii de secvențiere ADN.

Un studiu recent publicat prezintă rezultatele secvențierii ADN-ului a 230 de indivizi din Europa și Asia care au trăit între anii 6500 î.e.n. și 300 î.e.n.

Autorii studiului au confirmat că primele gene alele care codează enzima lactază, importantă în digestia laptelui, au apărut în ultimii 4000 de ani. Cea mai veche apariție a acestei gene, în colecția din acest studiu, aparține unui individ care a trăit între anul 2450 și 2140 î.e.n.

Surprinzător, în unele dintre mostrele ADN s-a găsit o alelă a genei  SLC45A2, una dintre genele responsabile pentru culoarea deschisă a pielii. În prezent, această alelă este aproape fixată în populația europeană.

O alelă a genei EDAR, responsabilă pentru o morfologie specială a dinților și o anumită grosime a părului a fost găsită în ADN-ul a 3 indivizi scandinavi vânători-culegători. Această alelă este foarte des întâlnită azi, în Asia de est și la indienii americani. Aceste alele lipsesc în populația europeană actuală, cu excepția Scandinaviei.

Articolul poate fi citit aici: Mathieson, Iain, et al. “Genome-wide patterns of selection in 230 ancient Eurasians.” Nature (2015).

 

pseudostiinta: 1. Homeopatia

Cele mai controversate două subiecte din edițiile Wikipedia în limbile engleză, franceză, germană și spaniolă, cu pagini modificate cel mai des,  sunt Isus Cristos și homeopatia [2].

Medicina alternativă și complementară include diferite practici cum ar fi acupunctura, plantele medicinale, homeopatia sau cristalele tămăduitoare. Mulți oameni cred că aceastea oferă remedii reale și reprezintă o alternativă validă la medicamentele sintetice produse de marile companii famaceutice (bigpharma). Susținătorii homeopatiei pretind că produsele lor pot fi folosite alături de medicina convențională.

Homeopatia își are originea în vremurile în care medicina făcea mai mult rău decât bine. Homeopatia se bazează pe descrierea  istoriei personale a pacientului și prescrierea tratamentelor personalizate. Unul dintre principiile homeopatiei este diluarea substanței active pentru a-i crește eficiența. În acest fel, substanțele sunt adeseori diluate până când în diluție se ajunge să nu mai existe nicio moleculă din substanța inițială. Succesul homeopatiei se datorează în mare parte  duratei îndelungate a consultațiilor și atenției acordate pacienților de către doctorii homeopați, dar și lipsei efectelor adverse [3].

Problema produselor homeopate este că eficiența lor  nu este susținută de dovezi științifice. Produsele homeopate nu prea sunt supuse testelor clinice riguroase. De aici apare îngrijorarea oamenilor de știință, de la faptul că unii pacienți refuză medicina convențională în schimbul medicii alternative.

Cu toate acestea, este important de menționat că atât sistemul național de sănătate din Marea Britanie, cât și cel din Germania, decontează unele rețete homeopate.

Pe de altă parte, unele practici ale medicinei alternative, cum ar fi masajul, osteopatia sau chiropractica au fost demonstrate ca fiind eficace.

Cine crede în beneficiile homeopatiei ..?

Un studiu recent în care au fost chestionați 1179 de adulți peste 18 ani din Marea Britanie a arătat că aproape 40% dintre respondenți cred atât în eficacitatea medicamentelor homeopate, cât și în eficacitatea medicinei convenționale.

Chestionarul nu a inclus nicio întrebare explicită cu privire la părerea oamenilor despre medicina alternativă sau medicina convențională. În schimb a adresat întrebări de felul: “Credeți în împortanța studierii științei în școală?” sau “Credeți că genetica va duce la noi descoperiri în domeniul medical?”

Categoria celor care susțin idei contradictorii (sunt și pentru medicină convențională, dar și pentru homeopatie)  este dominată de femei care nu au diplomă de facultate în științe, nu sunt interesate de cercetarea medicală și au în general puține cunoștințe de știință [1].

Doar o treime dintre respondenți sunt de acord doar cu principiile medicinei convenționale [1].

În timpul acesta, în Germania …

Un studiu efectuat în Germania a arătat că din 1503 de persoane intervievate, 60% au folosit remedii homeopate. 1.97% dintre doctorii germani sunt specializați și în homeopatie.

Până la urmă, nici nu economisești cu medicina homeopată…

Un studiu efectuat pe 44500 de persoane în Germania a arătat că
cheltuielile asociate pacienților care folosesc remedii homeopate sunt mai mari decât cheltuielile asociate pacienților care se rezumă la medicina convențională [3].
 Referințe
[1]Stoneman, Paul, et al. “Incommensurable worldviews? Is public use of complementary and alternative medicines incompatible with support for science and conventional medicine?.” (2013): e53174.
[2]http://www.naturalnews.com/047630_Wikipedia_academic_bias_homeopathic_medicine.html#
[3] Ostermann, Julia K., Thomas Reinhold, and Claudia M. Witt. “Can Additional Homeopathic Treatment Save Costs? A Retrospective Cost-Analysis Based on 44500 Insured Persons.” PloS one 10.7 (2015): e0134657.

 

Un minION pe urmele Ebola

Minion_blog

 

 

minION este probabil cel mai mic dispozitiv de secvențiere ADN, cam de dimensiunea unui iPhone. Cel mai mai nou kit poate citi aproximativ 75 baze azotate pe secundă (bp/s). minIONul este dezvoltat de compania Oxford Nanopore, și folosește, bineînțeles, tehnologia nanopore. ADN-ul este mărunțit în fragmente nu mai mari de 50.000 de perechi de baze azotate, care sunt apoi trecute printr-un por atașat unei membrane. Fiecare bază azotată are formă diferită și astfel crează un semnal diferit în nanopor. Avantajul tehnologiei nanopore este că secvențiatorul poate citi fragmente lungi de ADN (până la lungimea de 50.000 bp, față de mașinile Illumina, care citesc fragmente de maxim 250 de bp), care pot fi folosite ușor în asamblarea de novo.

MinION close up
Imagine: Oxford Nanopore Technologies

minION pe urmele virusului Ebola

Epidemia de Ebola din vestul Africii a făcut mai mult de 11.000 de victime. Studentul Josh Quick de la Universitatea Birmingham a fost trimis în Guinea pentru a stabili o hartă a transmisiei virusului pe baza secvențelor ADN ale acestuia. Josh Quick a plecat în Africa cu un laborator portabil (cam de mărimea a două valize), constând din trei dispozitive de secvențiere minION, laptopuri, un dispozitiv Qubit pentru măsurarea cantității de ADN și alte câteva echipamente adiționale.
În timpul celor 2 săptămâni petrecute in spitalul Donka din Conakry, Josh a secvențiat 14 genomuri ale virusului Ebola, în mai puțin de 48 de la colectarea mostrelor de sânge de la pacienți. Niciodată până acum epidemiologii nu au putut avea acces atât de rapid la un virus, în timpul unei epidemii.

Munca lui Josh a fost continuată de cercetători locali. În prezent există mai mult de 1000 de genomuri secvențiate ale virusului Ebola.

Pe websitul ebola.nextflu.org puteți explora evoluția virusului Ebola de la începutul epidemiei actuale.
Secvențierea a arătat că există a mare transmisie a virusului pe granița dintre Guinea și Sierra Leone.

http://lab.loman.net/2015/06/05/real-time-genomic-surveillance-of-ebola-outbreak-2014-2015/

http://www.nature.com/news/pint-sized-dna-sequencer-impresses-first-users-1.17483

Imagini

Adevăr și mit despre rezistența la antibiotice

Mai mult de 9500 de cetățeni din 12 țări din toată lumea (Barbados, China, Egipt, India, Indonesia, Mexic, Nigeria, Rusia, Serbia, Africa de Sud, Suda și Vietnam) au răspuns întrebărilor unui chestionar referitor la rezistența la antibiotice.

Iată numai câteva dintre idele greșite ale acestora cu privire la folosirea antibioticelor

* Trei sferturi dintre respondenți (76%) cred că rezistența la antibiotice are loc atunci când organismul uman este rezistent la antibiotice. În realitate, bacteriile, nu oamenii sau animalele, devin rezistente la antibiotice, iar împrăstierea bacteriilor cauzează infecții greu de tratat.

*Două treimi (66%) dintre respondenți cred că oamenii care respectă modul de administrare al anbibioticelor prescrise de doctori nu sunt in pericol. Aproape jumătate (44%) dintre cei intervievați cred că rezistența la antibiotice este doar problema oamenilor care iau antibiotice în mod regulat. În realitate, oricine, la orice vârstă, în orice țară, poate dobândi o infecție cu bacterii rezistente la antibiotice.

*Mai mult de jumătate (57%) dintre respondenți cred că ei, personal, nu pot face nimic pentru a stopa rezistența la antibiotice, în timp de două treimi (64%) cred că experții din domeniul medical vor putea rezolva problema rezisteței la antibiotice înainte ca aceasta să devină de neoprit.

Iată cum arată rezultatele din Egipt (511 interviuri față în față)
Mai mult de trei sferturi dintre respondenți spun că au luat antibiotice în ultimele 6 luni, iar 72% spun că acestea au fost prescrise de un doctor sau de o asistentă.
55% dintre respondenți cred, în mod eronat, că trebuie să nu mai ia antibiotice în momentul în care se simt mai bine, în loc de a continua întregul tratament. Mai multe de 3 sferturi cred, în mod eronat, că antibioticele pot trata răceala și gripa. Mai puțin de un sfert (22%) au auzit de termenii de resistență la antibiotice.


Date de la Organizația Mondială a Sănătății, Noiembrie 2015

Bioinformatică sau biologie teoretică

Bioinformatica, biologia teoretică … ce au ele în comun și ce le diferențiază?

Ceea ce unește aceste domenii este faptul că amâdouă sunt aplicații ale informaticii în biologie.

Îmi amintesc cât de plictisitoare erau lecțiile de biologie în liceu. Practic doar pagini cu descrieri, liste și scheme care trebuiau învățate pe de rost. Un informatician ca mine murea de plictiseală …

Târziu, mult mai târziu, am aflat câte aplicații aveau informatica, matematica și fizica în biologie.

Mulți dintre voi veți fi auzit de bioinformatică, dar ce este aceasta?  Din păcate nu există o definiție strictă pentru bioinformatică. Probabil cei mai mulți cercetători ar defini bioinformatica precum știința care analizează și interpretează informația genetică, pe scurt ADN-ul, ARN-ul și proteinele.

Și mai simplificat, bioinformaticienii interpretează texte lungi scrise în două “alfabete”: “alfabetul ADN-ului” format din patru litere (A, C, G, T (sau U, în cazul ARN)) și “alfabetul proteinelor” format din 20 de litere, câte o literă pentru fiecare amino acid.

GTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCACTG reprezintă un fragment din gena BRCA2, a carei mutatii cauzează cancer.
Alfabetul ADN poate fi tradus în alfabetul proteinelor, cu ajutorul codului genetic. Fiecare grup de trei litere ADN reprezintă o literă în alfabetul proteinelor. Bineînțeles, funcția de transformare a literelor ADN în literele proteinelor nu este injectivă. Mai multe grupuri de litere ADN duc spre același amino acid. De exemplu, GGU, GGC, GGA și GGG se traduc prin Gly, adică amino acidul glicină.

Câteva probleme pe care le adresează bioinformatica ar fi

1. Determinarea mutațiilor care cauzează boli genetice sau cancer.
Având ADN-ul unei persoane sănătoase și ADN-ul unei persoane bolnave, bioinformaticienii caută diferențele dintre cele două.
Practic ei analizează două șiruri de litere, să spunem un șir care reprezentă o genă sănătoasă și un șir care reprezintă copia acelei gene de la individul bolnav, pentru a înțelege care sunt mutațiile/diferențele care cauzează boala.

2. Determinarea exprimării genetice.
Într-o celulă, unele părți ale ADN-ului “sunt citite” mai des decât altele (unele gene sunt transcrise în ARN mai des decât altele). În celulele din diferite organe sunt transcrise diferite părți ale aceluiași ADN. Pentru a afla care sunt genele cele mai des exprimate în anumite celule, cercetătorii extrag ARN-ul din acestea. ARN-ul extras este apoi secvențiat (citit) de anumite mașini, care produc multe șiruri de A, C, T, G. Bioinformaticienii construiesc algoritmi care interpretează aceste șiruri de date și determină care sunt genele exprimate cel mai des în celulele analizate.

3. Determinarea legăturii dintre două specii.
De multe ori am auzit că omul modern este înrudit cu omul de Neanderthal. Dar ce înseamnă aceasta? Cercetătorii au secvențiat ADN-ul omului modern și al omului de Neanderthal. Bioinformaticienii caută similaritățile dintre acestea.

4. Un exemplu de proiect de bioinformatică ar fi determinarea locațiilor genelor din ADN-ul bacteriilor Streptococcus care codează toxine care pot omorî alte bacterii. Genele care codează toxine se aseamănă între ele. După ce o genă a fost validată experimental ca fiind toxină, bioinformaticianul poate rula algoritmi care căută alte gene asemănătoare în ADN pentru a descoperi noi variate de toxine.

Fenomenele complexe din natură sunt adesea greu de replicat în laborator, fie pentru că durează prea mult, fie pentru că sunt prea scumpe, fie pentru că lipsește informația completă … În asemenea cazuri, pentru înțelegerea lor, este nevoie de simulări computerizate.
Simulările, atunci când nu sunt corelate cu experimente, fac de obicei obiectul biologiei teoretice. Un studiu de biologie teoretică este simularea unei comunități de bacterii cu scopul de a determina ce fel de comportament duce la conviențuirea lor în număr cât mai mare. Un alt studiu de biologie teoretică ar fi determinarea procesului prin care europenii au ajuns să poată digera produsele lactate, în absența informațiilor genetice.

Ce aseamănă biologia teoretică de bioinformatică este faptul că în ambele domenii cercetătorii lucrează numai la calculator (în general nu există muncă de teren, sau muncă de laborator). Bineînțeles, ecuațiile din biologia teoretică ar putea fi rezolvate și “de mână”, în absența calculatorului, dar cercetătorii din ziua de azi preferă de regulă ajutorul programelor precum Matlab, Mathematica sau R.

În rest, există puține intersecții între cele două… deși aici ați putea veni cu contra-exemple.

Colaborarea științifică în 2014/2015

Revista Nature a publicat un grafic al colaborărilor științifice la nivel global, bazat pe indexul Nature (explicat mai jos). Echipa Nature a analizat instituțiile de cercetare la care sunt afiliați autorii articolelor științifice de calitate publicate în ultimul an, și tările în care se află acestea.
Graficul arată că, deloc surprinzător, Statele Unite domină lumea prin numărul publicațiilor științifice, dar și prin numărul de colaborări (26.721 articole științifice de calitate publicate în ultimul an, cele mai multe în domeniile fizicii și științelor vieții).

Conform indexului Nature, Instituțiile din România au publicat în anul precedent 122 de articole științifice de calitate, 92 în domeniul fizicii. Cele mai multe colaborări cu instituții din străinătate le-a avut Institutul National de Cercetare-Dezvoltare pentru Fizica si Inginerie Nucleara Horia Hulubei, urmat de Institutul Național de Fizica Materialelor. Țările cu care România colaborează cel mai des sunt Germania, Franța și Italia.

top institutii romania

 

 

 

 

 

 

 

 

Indexul Nature este un indicator global al cercetării de înaltă calitate. Indexul Nature urmărește afiliațiile autorilor articolelor de calitate. Indexul este actualizat lunar.

http://www.natureindex.com/country-outputs/collaboration-graph?WT.mc_id=SOCIAL_1511_INDEXCOLLAB

Secretele genomului neanderthalian

Multă vreme s-a crezut că omul modern Homo sapiens și omul de Neanderthal erau două specii diferite. La un moment dat a apărut ipoteza că omul de Neanderthal s-ar fi reprodus cu omul modern, printr-un fenomen pe care oamenii de știință îl numesc amestecare genetică (genetic admixture în engleză).
Fenomenul este explicat de desenul de mai jos.

neanderthal_arbore

 

 

 

În anul 2010 o echipă mare de cercetători din mai multe țări a publicat prima versiune a genomului Neanderthalienilor. Bineînțeles, una dintre primele întrebări la care au vrut să răspundă a fost dacă Neandertalli s-au amestecat cu omul modern.

Singurul segment de ADN neanderthalian pe care cercetătorii îl analizaseră până în 2010 a fost ADN-ul mitocondrial, dar aceste analize nu au dat un răspuns conclusiv.

Pentru a răspunde la marea întrebare, cercetătorii au formulat următoarele ipoteze:

Ipoteza nulă: Dacă oamenii moderni din toate regiunile globului se aseamănă în mod uniform cu neanderthalii, atunci oamenii de Neanderthal nu s-au amestecat cu oamenii moderni (ultimul schimb de ADN s-a produs înainte ca cele două specii să diveargă).
Ipoteza alternativă: Dacă în schimb, oamenii de Neanderthal se aseamană mai mult cu oamenii moderni din unele regiuni ale globului și mai puțin cu oamenii din alte regiuni, atunci avem motive să credem că cele două specii s-au amestecat.


Metodologia

Secvențierea genomului neanderthalian a fost dificilă deoarece oasele antice sunt în general contaminate cu ADN-ul microbilor care au colonizat individul după moartea acestuia. Metoda principală de recuperare a ADN-ul antic este reacția de polimerizare în lanț. În cazul construcției genomului neanderthalian cercetătorii s-au folosit și genomurile deja complete ale omului modern și al cimpanzeului.
Cercetătorii au folosit mostre de schelete neandethaliane găsit în Peștera Vindija din Croația, datând din aprox. anul 34.000 î.e.n., dar și mostre din Valea Neander (Germania), El Sidron (Spania) și Mezmaiskaya (Rusia).


Rezultate

Surprinzător, Neanderthalii sunt mai apropiați genetic de europeni, decât de non-europeni.
O teorie mai veche susținea că omul modern își avea originea într-o pupulație relativ redusă de oameni din Africa, iar în cursul evoluției nu avusese loc nicio amestecare cu alte populații. Studiul din 2010 contrazice această teorie, susținând că aproximativ pâna la 4% din genomurile oamenilor din Eurasia ar fi de origine neanderthaliană.

De asemenea oamenii de știință au descoperit că amestecarea omului modern cu omul de Neanderthal s-a petrecut înainte de diversificare asiaticilor de europeni.

Green, Richard E., et al. “A draft sequence of the Neandertal genome.” science 328.5979 (2010): 710-722.

publică-ți ADN-ul, de dragul științei

De când cu moda Facebook-ului, informațiile private sunt împărtășite public benevol, ca și cum internetul ar fi un paradis fără hoți, pedofili, sau oameni care ar vrea să îți vândă ceva la fiecare click. Unele familii au uitat de existența albumelor private de fotografii și publică totul online. Mai alaltăieri am sesizat pe Facebook un test de sarcină cu două liniuțe.
Peste 20 de ani, adolescenții vor fi consolați cu faptul că toți prietenii, colegii, profesorii lor etc. i-au vazut cum arătau în prima oră de la naștere, la prima băiță cu nașele, la botez etc, dar și că tot universul știe care le-au fost primele cuvinte, cu ce medie au terminat clasa întâi etc., dar și care au fost iubiții din liceu ai mamelor lor.

Însă ceea ce e mai grav, de abia acum urmează. Există informații și mai sensibile decât poza cu fața schimonosită a mamei imediat după naștere, publicate de un tată prea entuziast. ADN-ul.
Dacă pozele mai pot fi șterse, sau pot compromite un număr limitat de persoane, publicarea ADN-ului cuiva poate compromite rudele apropiate de sânge, dar și generații de-a rândul. ADN-ul este transmis din generație în generație (duh!) și nu prea poate fi schimbat. Niciodată.

Dar prima oară să prezint contextul problemei.

Secvențierea primului genom s-a încheiat în 2003 și a fost rezultatul muncii a numeroase instituții din Europa, America și Asia.
De atunci costurile secvențierii unui genom uman “au bătut” legea lui Moore (vezi imaginea de mai jos). În curând vom putea secvenția un întreg genom uman cu mai puțin de 1000 de USD.

cost_per_genome

Companii precum 23andme secvențiază și analizează parțial genomurile clienților cu mai puțin de 100 de USD.
De asemenea, studii ample de cercetare secvențiază genomurile unui larg segment de populație cu scopul de a descoperi cauzele genetice ale diferitelor boli, precum Parkinson sau Alzheimer.

Ideea e că multe, multe persoane au fost deja secvențiate, sau vor fi secvențiate în viitorul apropiat.

Companiile farmaceutice, dar și unele instituții de cercetare, încurajează oamenii să își facă publice rezultatele secvențierii. Motivația ar fi că astfel “încurajăm noile descoperiri”. Proiectul http://www.personalgenomes.org/ este doar un exemplu în acest sens.

Pe de altă parte, specialiștii în data privacy sunt de cu totul altă părere. Există mai multe motive pentru care publicarea ADN-ului este periculoasă. Ai vrea ca angajatorul tău să știe că bunica purta o genă dominantă care cauzează cancer? Simplu, nu.
Sau că ai un risc ridicat de a dezvolta o afecțiune înainte de vârsta pensiei ..? Nu.

Soluții

Secvențierea unei populații poate aduce clar multe beneficii, dar de multe ori, pentru analiza unei boli genetice, nu este necesară secvențierea integrală a tuturor genomurilor. Anumite părți ar putea rămâne nesecvențiate pentru a păstra anonimitatea subiecților. Atunci când vă oferiți voluntari să participați într-un studiu de cercetare în care vă este secvențiat ADN-ul, întrebați despre măsurile de protecție.
De asemenea, asigurață-vă că bazele de date care păstrează informații sensibile sunt securizate foarte, foarte bine.

Însă, cel mai important pas în a vă proteja e să nu vă publicați informațiile genetice pe websituri precum http://www.personalgenomes.org/ .

Imagine