Bioinformatică sau biologie teoretică

Bioinformatică sau biologie teoretică
1 cititori au dat 5

Bioinformatica, biologia teoretică … ce au ele în comun și ce le diferențiază?

Ceea ce unește aceste domenii este faptul că amâdouă sunt aplicații ale informaticii în biologie.

Îmi amintesc cât de plictisitoare erau lecțiile de biologie în liceu. Practic doar pagini cu descrieri, liste și scheme care trebuiau învățate pe de rost. Un informatician ca mine murea de plictiseală …

Târziu, mult mai târziu, am aflat câte aplicații aveau informatica, matematica și fizica în biologie.

Mulți dintre voi veți fi auzit de bioinformatică, dar ce este aceasta?  Din păcate nu există o definiție strictă pentru bioinformatică. Probabil cei mai mulți cercetători ar defini bioinformatica precum știința care analizează și interpretează informația genetică, pe scurt ADN-ul, ARN-ul și proteinele.

Și mai simplificat, bioinformaticienii interpretează texte lungi scrise în două „alfabete”: „alfabetul ADN-ului” format din patru litere (A, C, G, T (sau U, în cazul ARN)) și „alfabetul proteinelor” format din 20 de litere, câte o literă pentru fiecare amino acid.

GTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCACTG reprezintă un fragment din gena BRCA2, a carei mutatii cauzează cancer.
Alfabetul ADN poate fi tradus în alfabetul proteinelor, cu ajutorul codului genetic. Fiecare grup de trei litere ADN reprezintă o literă în alfabetul proteinelor. Bineînțeles, funcția de transformare a literelor ADN în literele proteinelor nu este injectivă. Mai multe grupuri de litere ADN duc spre același amino acid. De exemplu, GGU, GGC, GGA și GGG se traduc prin Gly, adică amino acidul glicină.

Câteva probleme pe care le adresează bioinformatica ar fi

1. Determinarea mutațiilor care cauzează boli genetice sau cancer.
Având ADN-ul unei persoane sănătoase și ADN-ul unei persoane bolnave, bioinformaticienii caută diferențele dintre cele două.
Practic ei analizează două șiruri de litere, să spunem un șir care reprezentă o genă sănătoasă și un șir care reprezintă copia acelei gene de la individul bolnav, pentru a înțelege care sunt mutațiile/diferențele care cauzează boala.

2. Determinarea exprimării genetice.
Într-o celulă, unele părți ale ADN-ului „sunt citite” mai des decât altele (unele gene sunt transcrise în ARN mai des decât altele). În celulele din diferite organe sunt transcrise diferite părți ale aceluiași ADN. Pentru a afla care sunt genele cele mai des exprimate în anumite celule, cercetătorii extrag ARN-ul din acestea. ARN-ul extras este apoi secvențiat (citit) de anumite mașini, care produc multe șiruri de A, C, T, G. Bioinformaticienii construiesc algoritmi care interpretează aceste șiruri de date și determină care sunt genele exprimate cel mai des în celulele analizate.

3. Determinarea legăturii dintre două specii.
De multe ori am auzit că omul modern este înrudit cu omul de Neanderthal. Dar ce înseamnă aceasta? Cercetătorii au secvențiat ADN-ul omului modern și al omului de Neanderthal. Bioinformaticienii caută similaritățile dintre acestea.

4. Un exemplu de proiect de bioinformatică ar fi determinarea locațiilor genelor din ADN-ul bacteriilor Streptococcus care codează toxine care pot omorî alte bacterii. Genele care codează toxine se aseamănă între ele. După ce o genă a fost validată experimental ca fiind toxină, bioinformaticianul poate rula algoritmi care căută alte gene asemănătoare în ADN pentru a descoperi noi variate de toxine.

Fenomenele complexe din natură sunt adesea greu de replicat în laborator, fie pentru că durează prea mult, fie pentru că sunt prea scumpe, fie pentru că lipsește informația completă … În asemenea cazuri, pentru înțelegerea lor, este nevoie de simulări computerizate.
Simulările, atunci când nu sunt corelate cu experimente, fac de obicei obiectul biologiei teoretice. Un studiu de biologie teoretică este simularea unei comunități de bacterii cu scopul de a determina ce fel de comportament duce la conviențuirea lor în număr cât mai mare. Un alt studiu de biologie teoretică ar fi determinarea procesului prin care europenii au ajuns să poată digera produsele lactate, în absența informațiilor genetice.

Ce aseamănă biologia teoretică de bioinformatică este faptul că în ambele domenii cercetătorii lucrează numai la calculator (în general nu există muncă de teren, sau muncă de laborator). Bineînțeles, ecuațiile din biologia teoretică ar putea fi rezolvate și „de mână”, în absența calculatorului, dar cercetătorii din ziua de azi preferă de regulă ajutorul programelor precum Matlab, Mathematica sau R.

În rest, există puține intersecții între cele două… deși aici ați putea veni cu contra-exemple.

Alte articole din aceeași categorie

    Ți-a plăcut articolul? Urmărește-ne pe Twitter @Streptococcul

    Lasă un răspuns

    Adresa ta de email nu va fi publicată. Câmpurile necesare sunt marcate *

    Poți folosi aceste taguri și atribute HTML: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>